Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W224C03
Clone ID W224C03
Vector ROSAbetageo
Project ggtc

Sequence tag W224C03
Sequence
AGAGGCGCCGAGGAGGAAGAGCGAGCCCGGACGGTGCCCCTAGGCCGAGTGTGAGCACCGCCAGGATGACGACTTCAGGC
GCTCTGTTCCCAAGCCTGGTGCCCGGCTCTCGGGGGTCTTCTACCAAATATTTGGTGGAGTTCCGGGCAGGAAAAATGTC
ATTAAAAGGAACTACGGTCACCCCAGATAAACGGAAAGGTCTCGTGTACATCCAGCAGACGGACGACTCCCTTATTCACT
TCTGTTGGAAACACAGCCCCTCTTGAACC
Sequence Type mRNA
Unitrap ID UNI11005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179906332..179906943 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039041 (Adrm1) NM_019822 adhesion regulating molecule 1 Gene [Source:MGI (curated);Acc:Adrm1-001]

 
Come back to gene ENSMUSG00000039041


For any suggestions or comments, please send an email to unitrap@crg.es