Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A064A08
Clone ID A064A08
Vector pT1betageo
Project ggtc

Sequence tag A064A08
Sequence
GAGACCCAGAATCCAACTCAGGTTGGAACAGCTCTTCAGGTTTTCCATAACCTCGGGACTTTGAAGGAGACTGTTACCAG
TGTCGTGGATGGCTATTGTGCTGCTTTGGAAGACAGCATCAACAATGCATTGGACGTCAAAGTTTTGACTCAGCCTTCCC
AGTCAGCTGTTCAAG
Sequence Type mRNA
Unitrap ID UNI11007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32475709..32475877 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es