Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W219E03
Clone ID W219E03
Vector ROSAbetageo
Project ggtc

Sequence tag W219E03
Sequence
CGAGGACGCGGACACTGAGCCCGCGCACGGCCGGCAGCACACACCCTGCCTGTTCTGTTTCAG
Sequence Type mRNA
Unitrap ID UNI5391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 57034021..57034083 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030505 (Prmt3) NM_133740 protein arginine N-methyltransferase 3 Gene [Source:MGI (curated);Acc:Prmt3-001]

 
Come back to gene ENSMUSG00000030505


For any suggestions or comments, please send an email to unitrap@crg.es