Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14978B10
Clone ID IST14978B10
Vector VICTR76
Project tigm

Sequence tag IST14978B10HMF2
Sequence
GTGTGAGGTGGAATCTCAGGGTTGTTTTGATTTGCATTTCCCTGATGATTAAGGATGTTGAACATTTTTTCAGGTGCTTC
TCTGCCATTCGGTATTCCTCAGGTGAGAATTCTTTGTTCAGTTCTGAGCCCCATTTTTTAAGGGGGTTATTTGATTTTCT
GAGGTCCACCTTCTTGAGTTCTTTATATATGTTGGATATTANTCCCCTATCTGATTTANGATAGGTAAAGATCCTTTCCC
ANTCTGTTGGTGGTCTTTTTGTCTTATCNACNNTGTCNTTTGCCTTN
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI29644 UNI30806 UNI30807 UNI30809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166335: 9987..10272 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 52605..52890 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166436: 152743..153028 270
 
EST/CDNA Est Name
  BM215206.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166440: 197672..197957 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166342: 78366..78651 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161937: 231406..231691 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2535500..2535785 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 11226274..11226559 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10876622..10876907 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11687568..11687853 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14810443..14810728 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4365095..4365380 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7124689..7124974 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9685136..9685421 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7821915..7822200 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4766619..4766904 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3172191..3172476 270
 
EST/CDNA Est Name
  BU743854.1 - CA464211.1 - BY080252.1 - DV072109.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5251055..5251340 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3824809..3825094 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6651044..6651329 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5669122..5669407 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3982714..3982999 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5636984..5637269 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4165375..4165660 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5266894..5267179 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8106141..8106426 270
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3490736..3491021 270
NO GENE  


Sequence tag IST14978B10BBF1
Sequence
GTGTGAGGTGGAATCTCAGGGTTGTTTTGATTTGCATTTCCCTGATGATTAAGGATGTTGAACATTTTTTCAGGTGCTTC
TCTGCCATTCGGTATTCCTCAGGTGAGAATTCTTTGTTCAGTTCTGAGCCCCATTTTTTAAGGGGGTTATTTGATTTTCT
GAGGTCCACCTTCTTGAGTTCTTTATATATGTTGGATATTAGTCCCCTATCTGATTTAGGATAGGTAAAGATCCTTTCCC
AGTCTGTTGGTGGTCTTTTTGTCTTATAGACNGTGTCTTTTGCCTTGCANANNCTTTNNANTTTCATTANGTCCCATTTG
TCNNTTCNCNATCTTACNNCNCAAGCNNNNNNNNTTCTGTTCAGGAANTTTTNCCCTGTGCCCNTANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14978B10HMR1
Sequence
CACCANTGAGAATGGCTAANATNAAAAATTCAGGTGACAGCAGATGCTGGCNANGATGTGGAGAAAGANGAACACTCCTC
CATTGTTGGTGGGATTGCAGGCTTGTACAACCACTCTGGAAATCANTCTGGCGGTTCCTCANAAAATTGGACATAGTACT
ACCGGAGGATCCNNCANTACCTCTCCTGGGCATATATCCAAAANAAGCCCCAACTGGTAANAAGGACACATGCTCCACTA
TGTTCATAGCANCCTTATTTATAATANCCNNAANCTGGAAAGAACCCANATGCCCCTCAACAGANGAATGGATACNGAAA
ATGTGGTACATCTACACAATGGAGTACTACTCANCTATTAAAAAGAATGAATTTATGAAATTCCTANCCNAATGGATGGA
CCTGGANAGCATCATCCTGAGTGAGGTAACACAATCACAAANGANCTCACACAATATGTACTCACTGATAAGTGGATACT
NNCCCAAAACCTANNATACCCACNATATAAGATACAATTTCCTANCACATGANACTCANGANAANTGANNACTGANNTGT
GNNCACTATGCCCCTCCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000049119


For any suggestions or comments, please send an email to unitrap@crg.es