Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12252F5
Clone ID IST12252F5
Vector VICTR76
Project tigm

Sequence tag IST12252F5HMF2
Sequence
AGACTAATTTCCTAAGTTCGGCGGGTCTCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGA
Sequence Type genomic DNA
Unitrap ID UNI13814 UNI30735 UNI30806 UNI30809 UNI30810 UNI31440

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114281..114345 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 133720..133784 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 30735495..30735559 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10881638..10881702 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692584..11692648 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 41060773..41060837 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 21805828..21805892 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14306246..14306310 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 11555309..11555373 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7827357..7827421 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 26214893..26214957 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 23654786..23654850 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063458 (1700112E06Rik) RIKEN cDNA 1700112E06 gene Gene [Source:MGI Symbol;Acc:MGI:1923883]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5256071..5256135 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3913339..3913403 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 9095287..9095351 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046178 (Nxph1) NM_008751 neurexophilin 1 Gene [Source:MGI Symbol;Acc:MGI:107492]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19038923..19038987 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8711324..8711388 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040584 (Abcb1a) NM_011076 ATP-binding cassette, sub-family B (MDR/TAP), member 1A Gene [Source:MGI (curated);Acc:Abcb1a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 13223621..13223685 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5654155..5654219 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17432363..17432427 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16303038..16303102 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026748 (Plxdc2) NM_026162 plexin domain containing 2 Gene [Source:MGI (curated);Acc:Plxdc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13727159..13727223 65
NO GENE  


Sequence tag IST12252F5BBF1
Sequence
TCAGGATACCTAATTTCTTCTTGTTTCTTTGTTGTTGTACTTAACAAACTGGGACCAACAGCAACCAACAGCAACCAACC
AACAACCAATAACCCACCCTACCTCTCAGGGCCCTAGCATTTATATACCCTCTGAAAAGTCCCCANAATTCCAAACGGCA
TATAAACGCAAAAATTATCTGCCACTGGCAAAATCACGCCTCTGCTAGAGCATGAGGCAAACCATAGTCAACTACTGTGG
ACAATCTAAAGCAGCCCCATATCCCACACCTGGAAGTAAAATTAAAACATAGTCACGTATTTCTGTGGAGTTTTTTATTG
TTTGGTTGGCTTTGTTTTTTTTTTTTTTTTTTTTTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 154765338..154765695 354
NO GENE  

 
Come back to gene ENSMUSG00000026748


For any suggestions or comments, please send an email to unitrap@crg.es