Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M064D01
Clone ID M064D01
Vector ROSAbetageo
Project ggtc

Sequence tag M064D01
Sequence
GGCGGCGGCGCGCGGCAGGGGACCGTTGGTGTTTGCGTTGGCCGTAGTGGACTGGGCCGTGGACACCATGCAGCTGACCG
TGAAGGCGCTCCAGGGCCGGGAATGTAGCCTACAG
Sequence Type mRNA
Unitrap ID UNI11010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71613755..71613869 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015290 (Ubl4) NP_663380 ubiquitin-like 4 Gene [Source:MGI (curated);Acc:Ubl4-001]

 
Come back to gene ENSMUSG00000015290


For any suggestions or comments, please send an email to unitrap@crg.es