Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11865B10
Clone ID IST11865B10
Vector VICTR76
Project tigm

Sequence tag IST11865B10BBF1
Sequence
CTCTGTGTAGCTCTGGCTGTCCTGGAACTCTTTATGTAGATCANGGTAGCCTCAACTCAGAGAGATCCTCCTGCCTCTGG
AGTGCTAGGATTAAAGCATGTACCATTTCACCTGGCTTTGGATTAATAACTTTTAAAAATTTGTGTTGATTTTATGTGCA
TTGGTTTTGCCTGCATGTATATCTGTGGGAGGGTGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96606601..96606800 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031755 (Bbs2) NM_026116 Bardet-Biedl syndrome 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2135267]

 
Come back to gene ENSMUSG00000031755


For any suggestions or comments, please send an email to unitrap@crg.es