Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14959G6
Clone ID IST14959G6
Vector VICTR76
Project tigm

Sequence tag IST14959G6HMR1
Sequence
CAAAAATTAACATTTATTTCCTCCTTGCCTTTCTTTCCTTTAACCCCTCCTATGTACCCCCTCTCCAGCTCCTCTCATGC
TTCTCCAATACTTCCTTTTAAATTGATGTTCTCTTTTTTCTTATTATTGTTTATAATACATATACACATAAATATGTAAG
TTTAACCTGCTGAGTATGTTTAGTGATGCTGTGTGTTAGTGATTTTAGGGCTACTCACTTTGTATTGGATAACCACTAAG
GGGACTCAACCATGGATTCTTTCTCTTTTAACAGTCATTAGCTGCCAGTAGTACTTTGTACTGGGTGGAACCTCTGTGAN
ATTTCAACCTTCCATGTTCACAGGTCTGTCGGTATTGTTTTTGTTNANGTCTNATTTNNNAAGCCATATTGCTNACATAA
TATCTTCCCTGTTATTTCTGATNNACNTNATATTTTTANTNATTTGGTTTTTNGANACNNAGTCCTGGANCTCCTCTGTA
NAN
Sequence Type genomic DNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109875855..109876334 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]


Sequence tag IST14959G6BBF1
Sequence
NTNCCTNTGGGNNNNNNTNTTTCGNTTTANTNGNTNGNNNNTTTAATTANTTANTTGANACNNGNCTTACTCTGTTANCC
TGGCTGGCCTGGGACTCATCATTTTCCTGCTTCCATTTTTCAAGTGCTGGGATTATAGGCATTTGCCTCCNTGTCTAGCT
TCTTTTCCTTATATTANTAAGCNTCCCATTTATTTGTANTTTGTCTANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14959G6HMF2
Sequence
TGGCTTTTGGTTTTTGTTTTCCTTTCCCTGANATGGAAGGATNANTTGGTTGGCAGGTTGGTTATTTCCTTCCCAAGACA
GGGTCTCTCTCTGTATAGCCCTGGCTATCATGGTACTCACTATGTAGACCAGGCTGACTTCAAACTCNAGAGTGCTTCTT
GCCTTTGCCTCCGAAGTCCANAGATTAAAGGCATGTATCACCATACTTGGCAAANTANAATTTTAAAAATTGGGGCTGGA
NANATGGCTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109875565..109875815 233
NO GENE  

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es