Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W086A02
Clone ID W086A02
Vector pT1betageo
Project ggtc

Sequence tag W086A02
Sequence
ACCTGGAGATTTTCCTGAATGGGACAAATGGCTCTACTGAAGGGACCCTGCTAGAGAGATTGGATACTTGCCATACGCCC
TTTGGCAAGCGGCTCTTAAAACAGTGGCTCTGTGCCCCCCTCTGCAGCCCTTCTGCCATCAGTGACCGTCTAGATGCGGT
GGAAGATCTGATGTCCGTCCCTGACAAGGTCAATGAAGTTGCAGACCTATTAAAGAGAGCTGCTAGCCCTTGATAGGCTA
TTAA
Sequence Type mRNA
Unitrap ID UNI10647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88385374..88385612 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es