Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14233G5
Clone ID IST14233G5
Vector VICTR74
Project tigm

Sequence tag IST14233G5HMR1
Sequence
GCTTTCCTCCTCAGGAAATGCTTGCTGCCCCCAACTCCCCTCCCCCACTGGGTTTACAGCCTTGAANAAACCTTAAAAAA
TAATTAGAACATTTAAATATTTTTCAAAGTAGACTTAAAGGTTTTCTCTTGGCTTATACTTTCAATCACCTTTCCTCACC
CTTGCACAAAGAAGGGATGGTGTTTGACCTTGGCCACC
Sequence Type genomic DNA
Unitrap ID UNI11452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4542406..4542602 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019773 (Fbxo5) NM_025995 F-box protein 5 Gene [Source:MGI (curated);Acc:Fbxo5-001]


Sequence tag IST14233G5BBF1
Sequence
CCGCGAAACAGGGCACTTGGTTCACAAGGACCGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29231348..29231386 39

 
Come back to gene Mm.472490


For any suggestions or comments, please send an email to unitrap@crg.es