Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14722F1
Clone ID IST14722F1
Vector VICTR76
Project tigm

Sequence tag IST14722F1HMR1
Sequence
NCCTAGGGAAGGANCNNCTTANACNNNNNGTGGTGGGTCAGTGNNGGAATTCTTTGTTTTTTCTTTATCTATTTCATTTT
AATGTATAAAGTGTTTTGCTTATATGTACGTATATCTCAGTGGTCACTAAAGGGTCCAGATCCCCTGGAACTAGAGTTAC
AGATAGTTGTGAACGGTCATGTGGGTGCATGCAACCAATCCTGGTCCACTGGAAGAACAGCCAGTGCTCTTAATAGCTGA
ACCACTTCTTCNNCTCCTGCATTCTTATTTTTGAGAGAGGGACTCACTGTATATTCCANCATGGGTTTGATCTTGACACT
GTATTATCTTGGCCTTCTGAGTATAGACATGTGCTATCTGACTGGAAATANACCTTTTTAAAGGAGGAATTATNAAATTT
GTCTTATGAATTAAGAAACTAATTGAAACTAAATTATAAAA
Sequence Type genomic DNA
Unitrap ID UNI25702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109828693..109829087 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050199 (Lgr4) NM_172671 leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI (curated);Acc:Lgr4-002]


Sequence tag IST14722F1BBF1
Sequence
GGCTTTGTTGAATTTTTTCATTCACTATCAAGTTCTAGTTGCTTCTGAGTGGCAAACACAACACCACCCAGGATCTCCCC
GTTCTTTCATCTGCTATATTTACCTTGATTTTAGGGACAGAGTGAAAACATCTTTACAAACTCTAAAATTAAAAGTACTA
CCTGAAATTCTACTATAAGAGCCTTGCTTCTAAGGTTTTATAACACTTAAAATGCATGCAGCATGAGAAAACCTGACGCT
ACATGACCTCTGGTCCACAGCAGACATATGTTATACAGATGGATGAAATAAAACAACTCAGAAACCCCAATGGTGCGGAT
GATAATTAACTGCTTCCTCAGCAAAGGGTGACGATGCCAGATTCTTANTCNAGCCACAAGTGTACCATGGGGTGTAGGCC
ATCACTCATCACACCCTTCTAGTNNNNTGACTGACTGGAAGGCATGCCTTCTGANGCATCCTACTNNATACCATCNNCCN
TTNANNNACTGTCTAANAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109828155..109828650 464
 
EST/CDNA Est Name
  BE862318.1


Sequence tag IST14722F1HMF1
Sequence
GGCTTTGTTGAATTTTTTCATTCACTATCAAGTTCTAGTTGCTTCTGAGTGGCAAACACAACACCACCCAGGATCTCCCC
GTTCTTTCATCTGCTATATTTACCTTGATTTTAGGGACAGAGTGAAAACATCTTTACAAACTCTAAAATTAAAAGTACTA
CCTGAAATTCTACTATAAGAGCCTTGCTTCTAAGGTTTTATAACACTTAAAATGCATGCAGCATGAGAAAACCTGACGCT
ACATGACCTCTGGTCCACAGCAGACATATGTTATACAGATGGANGAANTAAAACANCTCAGAAACCCNNNTGGTGCGGAT
GATAATTAACTGCTTCCTCNNCAAAGGGTGACNANGCCNGATTCTTANTCNNGCNNCAAGTNNNNNNTGGGGTGTACGCN
ATCACTCNTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BE862318.1


For any suggestions or comments, please send an email to unitrap@crg.es