Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W062A04
Clone ID W062A04
Vector pT1betageo
Project ggtc

Sequence tag W062A04
Sequence
ACATCAGCTCCTGAAAAAACAANNGGCCGCATGTTCTTGGATTCTNNNNCGNNCTAGTAANNNTCAGACAGCTAGCAGCC
TGCNTNNANNNCAGAAGCAGANNCATCCGCCACGACTTGTGCACCAGAAGANTGTGCAAGAGCTATGGATGAGTCCATAC
CCTCCTATCCTGGAACTGCCATAGCAACACATGACAGCATTTGGTCCNNNGTCACAGAGGAAGGAGCAGAGCTGTCACAG
CGGCTCGTGAGGAGTGGTTTTGCTGGGCCTGTAATAGATCCTGAAAATGAAGAACTTATGCTGAACATCAGCTCTCGACT
ACAAGCAGCTGTTGAAAAAATCCTAGAAGCCATAACCCCCCCNNNCACTCAAAATGAACATGCGAAAGTTACACAGACAG
AGTTGATGCGTGAGTCCTTTAGACAAAAACAAGAGGCAACAGAGTCACTTCATTGCCTGGAAGAACTGCGAGAGCGCCTT
CAGGAGGAGTCCAGGGCCAGGGAGNNNNTGGCCGGGTAGCTCAATACNNNTNA
Sequence Type mRNA
Unitrap ID UNI11029

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4008405..4028527 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es