Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12917A3
Clone ID IST12917A3
Vector VICTR76
Project tigm

Sequence tag IST12917A3BBF1
Sequence
TTTTCATGCATAATAATGCATGCATACGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCTGACTGCTCTCCGAAGGTC
TGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATGTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98514417..98514530 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017211 (Gsdma2) NM_029727 gasdermin A2 Gene [Source:MGI (curated);Acc:Gsdma2-002]


Sequence tag IST12917A3HMF2
Sequence
TTTTNATGCATAATAATGCATGCATACGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCTGACTGCTCTCCGAAGGTC
TGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATGTGTAACAAGATCTGATTCCCTCTTCTGGAGTGTCTGA
AGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTAAAAAAAATGCATGCATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 134854737..134854930 186
NO GENE  

 
Come back to gene ENSMUSG00000017211


For any suggestions or comments, please send an email to unitrap@crg.es