Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W037B08
Clone ID W037B08
Vector pT1betageo
Project ggtc

Sequence tag W037B08
Sequence
AAGGNNNNGNTAAGCCCTCGGCCCTCCCTTCCAAACCCAGGGGGCTCATCTTCCAGTATGGGACTGCTGGATTTCGGACC
AATGCNNNGCATCTCGATCATATCATGTTTCGAATGGGATTGCTAGCTGTCTGCGGTCAAAGCAAACAAGATCTACCATT
GGAGTCATGGTTACGGCCTCACATAACCCTGAGGAAGACAATGGTGTGAAATTGGTTGATCCTTTGGGGGAAATGTTGGC
CCCTTCCTGGGAGGAGCATGCCACCTGTCTGGCCAGTGCGGAGGAGCAGGACGTGCGGCAAGTGCTTGCTGCCATCGTGG
AGAAAGAAGCTGTGGATCTGACACAGACCGCCTTCGTAGTCATTGCCAGAGACGCCAGGCCCAGCAGTGAGAAACTTTCA
CAATCTGTGATAGATGGCGTGACTGTTTTAGGAGGTCAATTCCAT
Sequence Type mRNA
Unitrap ID UNI11033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 86461117..86463992 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056131 (Pgm3) NM_028352 phosphoglucomutase 3 Gene [Source:MGI Symbol;Acc:MGI:97566]

 
Come back to gene ENSMUSG00000056131


For any suggestions or comments, please send an email to unitrap@crg.es