Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W053E07
Clone ID W053E07
Vector pT1ATGbetageo
Project ggtc

Sequence tag W053E07
Sequence
GAGCGGCCATTGGCGGCTTCAAAAGCACCTCGGCGGGAACCGCTGCAGAGACGGCGGGCGATGTGGACTGGAAGGGCATG
GTGCAGATAGATCACTCAGAATTAAGAATCTTCGGAAGTGCTAAGGATTGGGCACCCCACCCCGAAGGCCCTGATCTCCG
AAGTTTATAGCCGCATCTGGCCTG
Sequence Type mRNA
Unitrap ID UNI11036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 119445614..119446341 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031756 (Cenpn) NM_028131 centromere protein N Gene [Source:MGI Symbol;Acc:MGI:1919405]

 
Come back to gene ENSMUSG00000031756


For any suggestions or comments, please send an email to unitrap@crg.es