Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W096B04
Clone ID W096B04
Vector pT1betageo
Project ggtc

Sequence tag W096B04
Sequence
GAAGAATTTGCTCAGGAAATCATAACACTAATCCACAAAGTTAAAG
Sequence Type mRNA
Unitrap ID UNI1309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155993537..155993582 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es