Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635B8
Clone ID IST14635B8
Vector VICTR74
Project tigm

Sequence tag IST14635B8HMR1
Sequence
TTAGTGTGATGCAGAGCTGGGAATTTGGGGTACTCGTGTGCAGGGATGGAGTANTATAGTCACTGGTGTAAATTTTCGCT
AGTGTTTAGTTCCTCACGGTGCTATTTTCACCGCATCCTTGTAGCTGTGTTTTCTTTCCTCTCCTANAATTAAAGTAAGG
CANATCCAGGCCCAAAAGAGTAGGGTGGGACGGGACCAGCGGCCTCAAGGGAAAGGCCATGTAGGAGGTCGTTTANCTCT
GGGACAGTATGTTTACTCTTCAGACACTTGGGGTCAGCG
Sequence Type genomic DNA
Unitrap ID UNI14502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137438328..137438605 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019054 (Fis1) NM_025562 Friend virus integration site 1 Gene [Source:MGI (curated);Acc:Fis1-002]


Sequence tag IST14635B8BBF1
Sequence
CTAAGACCCCAGGCCTAGGTCTGAGTTGCTGAAACCCGGGAAGCTACAATTCCCGTCAGGCCTAGGGACACGAAGCCGAT
TCCCACAAGAAGCAGGATGCCGCAGAGGCTGCTGGGAGCCGTAGTTCAGCTTGCCAAGAAAGACGAAACCGGCACTGGTT
AGCCTCAGTCAGCTCTCCTCAGGAACTGCCCTTTCCAATTCTGCCCTTCTCCTTCCTCCGTCCCAGACCTTACCTTCAGA
TCCTCCACAGACACCAGCTCGTTCAGCACGGCCTCCATGGCCGCCGCCCCTGAAAGCCTCACACTAAGGTCTCTACTGGG
CCACAGTCTCCANNNNNNNGTANCAGGGGCGGAGANGCACTTNNGGCATCNNCCTGTGGANGCNNCGNNNCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019054


For any suggestions or comments, please send an email to unitrap@crg.es