Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046B7
Clone ID IST10046B7
Vector VICTR75
Project tigm

Sequence tag IST10046B7HMR1
Sequence
TCTTCGGGGTTTAGGCTGGAGCAGTTAAGGGGCGGGGACACTTACTGTGAATTAGATTTGAGGTGCTCGCTGCGGAGGAG
AACCTGGCTCTGGGCGCTGGTGTTGGCTCGGTCTGTAATAAGCATCCACACCTTTCGGGGTTCCGCTGGTTTTTATAGCT
GGGTGGAGGCAGCAGCGACGGCGGTGGCGGTGGTCCGGGCGGGGGGCGGGAACAATGTGCTTTTCCTGGAGGGGCNGAGG
CGCCNATGAGCTGGGCCGNCCNGANGGGCNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91225672..91225943 260
NO GENE  


Sequence tag IST10046B7BBF2
Sequence
CTACAGTGCTGGCCTACTGGCCGAGATCCCGCCCCAATAGGTACTAATGACTGCCTGGGTGTCTACACTCACCGCAGCAT
CCCAGGCTCCAATAACTCCTGTTGCGAGTCCGCAAGCTAGCCGCGCGGTCGTAGAACCAGCGCTTAGAAAGTGAATCCAA
TGCGGGCTGCCAGTGCGTGTGTTCACGCTTGCCGGCGTTTGCTGCGTGTGTAGATGGCGTTAAAGGCAGATGCGTCTGAG
CACCAGATAGAAAATACTTCTCTATTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91225981..91226253 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039830 (Olig2) NM_016967 oligodendrocyte transcription factor 2 Gene [Source:MGI (curated);Acc:Olig2-001]

 
Come back to gene ENSMUSG00000039830


For any suggestions or comments, please send an email to unitrap@crg.es