Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10065F10
Clone ID IST10065F10
Vector VICTR75
Project tigm

Sequence tag IST10065F10BBF2
Sequence
ACACACACACACACACACACACGCACACACACT
Sequence Type genomic DNA
Unitrap ID UNI31464 UNI31465 UNI31466 UNI31467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17149519..17149551 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054366 (Prune2) prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20607571..20607603 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001804 (Dsg4) NM_181564 desmoglein 4 Gene [Source:MGI (curated);Acc:Dsg4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 55628731..55628763 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18315797..18315829 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16733772..16733804 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 20258019..20258051 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 80640687..80640719 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 67058456..67058488 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 111965718..111965750 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 82724668..82724700 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 39081694..39081726 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3583705..3583737 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065952 (C330021F23Rik) NP_001019899 RIKEN cDNA C330021F23 gene Gene [Source:MGI Symbol;Acc:MGI:3612471]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73325904..73325936 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4661192..4661224 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046456 (BC022651) NM_177887 Transmembrane protein LOC284417 homolog Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q8R218]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38152484..38152516 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 6147429..6147461 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52828409..52828441 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 135970781..135970813 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 79613779..79613811 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16493621..16493653 33
NO GENE  


Sequence tag IST10065F10BBR1
Sequence
GTGTGTGTGTTTGATATTTCTGCTGTGATTGCGGTAACCTGCAATCTAGTGGGCTTATGTTTTATTTCTGTAATCTTTTT
TCTAATTCTTTTTCATTTCTATTTCTTATTTTATTTTATTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000046456


For any suggestions or comments, please send an email to unitrap@crg.es