Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W094E04
Clone ID W094E04
Vector pT1betageo
Project ggtc

Sequence tag W094E04
Sequence
CAAAAACTACTGGAATGTAAGGCTGCTTCTATGATGGAAACTGATGAGGAGTCTGTGAAAGAAGCATCGGATTTTGTGAG
AATGATGCTAGCTGCTGCCACCTCAAAAACCTGTGCCACAACCATAGCGTATCCACACG
Sequence Type mRNA
Unitrap ID UNI11045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96980612..96980750 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es