Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M030C07
Clone ID M030C07
Vector U3betageo
Project ggtc

Sequence tag M030C07
Sequence
CCCTCTCCCTAAATNNNAGTTGGGCGGGGGGGAAATGAAAACTGAGTTGGTCTTTACTTTTTTTAAAAGAGACTTTTTGA
TCCAATGAGGCCCCACAAGTAACTGAGTTTGGGTCCTGGTTG
Sequence Type mRNA
Unitrap ID UNI10120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054462..36054582 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es