Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14313E9
Clone ID IST14313E9
Vector VICTR74
Project tigm

Sequence tag IST14313E9HMR1
Sequence
TTCTGAATGTCTTATTTTGCATAGCGTAAGATTTTCAGTTGCATTGATTTACTGCAAATGTCAGGATTTCATTTTTCTTT
CTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI31477

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11705410..11705504 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es