Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14931B11
Clone ID IST14931B11
Vector VICTR76
Project tigm

Sequence tag IST14931B11BBF1
Sequence
AGTGGCCCACTAGGCACTCGCATTCCACGCCCGGCTCCACGCCAGCGAGCCGGGCTTCTTACCCATTTAAAGTTTGAGAA
TAGGTTGAGATCGTTTCGGCCCCAAGACCTCTAATCATTCGCTTTACCGGATAAAACTGCGTACGTCGGGAGCGAGAGCG
CCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAGGTCGG
ACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCANAGTTTCCTCTGGCTTCGCCCTGCCCAGGCATANTTCAC
CATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCG
GCGGACTNNNGANGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391262..57391690 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST14931B11HMR1
Sequence
ANNNTNGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCANACCC
CAGAAAAGGTGTTGGTTGATATAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 44964941..44965039 95
NO GENE  


Sequence tag IST14931B11HMF2
Sequence
ANGCAACCTTGGGCCTGAGGTGACCAGGAACCTAGCAGTGTGGTCTGAGGGATGAAAAGGGTCCCAGGCAGTTAGAAGCT
GAGGGATTTCCTGGGGAAGCAGAGACCTCAGCAGGCCTGTGTTGAGAACGTACTTTGTCTATATCTATACCACTCTTGTC
TCATCTAGGAAGCTAAGCAGGGTTGGGCCTGGTGAGTACTTGGATGGGAGAATCTACCCTCTGCCACTTGCCCTGGAAAC
CTATGAGGAACTGGGGGTGCTCAGGTGGGAGAGATAGCAGCTTCTCTCTGTCTGAGCTCATGGTGAACAGGTCAGTGGTN
TTGAAATGGANAGGGGGCANANNNNCTANACNAGGTGATACCNGAGCTNCNTTTGANANACNTGTAAGTCNNCTGCNTTA
CAGGGACCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es