Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14960H5
Clone ID IST14960H5
Vector VICTR76
Project tigm

Sequence tag IST14960H5HMR1
Sequence
CTGTTGTGTCTTGAAATGCTGTTTCCTTAAAGTCATTCATTACCTCTGGCTCTTACAGTCGTCCATCTCCTCTTCTCTAT
AAATCCCTGAGCTTTGAGGTGGGAGGGGTTTGATAAAAGATATTCCAATCCAGGCTAAGCACTCAAAAGTATTTCACTTT
GCATAGTGTCAAGTTGTGGTTATTTGTANTAATTACCTTCTAGAGGAANAAGGTGGTTTTCTTTTTCTTTTTTTTTNNGG
GTTN
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4813477..4813719 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST14960H5HMF1
Sequence
TTCAACAGGACAGATGCACATAGAGCCCAGANACTGATAGTTCAAGTCAGACACAATTCTAGCACAGAGGAGAGCAAGGA
GGCACCAAGTCCCACTCCTAGCCAAGAAGCTATTCACAACTGATAGCTGCTGGGGGAAAAACCAGTTCTCCTTAACCAAT
GACACTGAGTATGTGAACCACACTCTAGCAGATCCCGTGTTCAGGAATAGTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4813271..4813482 210
NO GENE  

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es