Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q998F10
Clone ID Q998F10
Vector ROSAbetageo0
Project ggtc

Sequence tag Q998F10
Sequence
CTCTCCTTTGCAGTCCTGAGCTCGCAGTTCCAGGTTTTGGTTGCTGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAA
CTTTCTAGCGCATGAGAAGATCTGGTTTGACAAGTTTAAATATGATGATGCAGAAAGGAGATTCTATGAGCAGATGAGCG
GGCCCATGCCATAAGTCNNCNCNCCAG
Sequence Type mRNA
Unitrap ID UNI11051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75731584..75739736 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]

 
Come back to gene ENSMUSG00000055762


For any suggestions or comments, please send an email to unitrap@crg.es