Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12315C3
Clone ID IST12315C3
Vector VICTR76
Project tigm

Sequence tag IST12315C3BBF1
Sequence
CAACCAAGCCCACAGGAGCTCTCATCCAAAGAAAGAGGACCTGTAGTCTGTGGCTTCTGCTTTGACAAAGGAACAGAAAA
CAGGCTTAAAATGGTAGCATGTAACCTTTAGAGTAAATGACTTAATGTAATAATTAAGAAGACTCCGGACAACAGTGGAG
CCTGGCTTCCTAGAGTATTGCCAAGAATCAGCCTGGCGTTTTGGTAAACAGAAGAGACTCCAGTGCAGAAGGCTCAGGGC
CAGGCGGGATACTTTCAGCGTCTGTTCTCTTTGTAAAACTAAGTCTTCGTTTGTTCAGATTGCTCCTTCCAGCAACTTTG
TATCTTTGGAGTCCTGGCATACTGAGTTAAAGTTTGTTTGGATCTGGCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI22501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90224785..90225158 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]


Sequence tag IST12315C3HMF1
Sequence
CAACCAAGCCCACAGGAGCTCTCATCCAAAGAAAGAGGACCTGTAGTCTGTGGCTTCTGCTTTGACAAAGGAACAGAAAA
CAGGCTTAAAATGGTAGCATGTAACCTTTAGAGTAAATGACTTAATGTAATAATTAAGAAGACTCCGGACAACAGTGGAG
CCTGGCTTCCTAGAGTATTGCCAAGAATCAGCCTGGCGTTTTGGTAAACAGAAGAGACTCCAGTGCAGAAGGCTCAGGGC
CAGGCGGGATACTTTCAGCGTCTGTTCTCTTTGTAAAACTAAGTCTTCGTTTGTTCANATTGCTCCTTCCAGCAACTTTG
TATCTTTGGAGTCCTGGCATACTGAGTTAAAGTTTGTTTGGATCTGGCTGGATCCCTCTGACAGAAGGGAGAAGTGTGGA
GTTGGCCGTTCTCTGANCACANGTGGTGTGNAANAAAACNNATTTGTTCTTGCCTACTGTTGTGTTCCACTCNATGTGTC
TGANNCNNNTNTGGCTTTNGNAN
Sequence Type genomic DNA
Unitrap ID UNI22501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90224661..90225158 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es