Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10654H10
Clone ID IST10654H10
Vector VICTR76
Project tigm

Sequence tag IST10654H10HMF1
Sequence
CACGCACACTCGGNCCCACGCACACGCGGCGGGCCCCGCGCCCACCGCCGCTTTCGCCTTCTGCACTCGGCGCGTCTGAT
TTTATTTCATGCTTCCTCGATTTCAATTTGCCGGGCCAGGCTTCCCCTGTCCCGGGAGAGCCAGCCTATCCCGGCTGGAG
CTTTCCGGAGTTCCGTGTCCTCGACTGGGCGGAGTAGGGTCA
Sequence Type genomic DNA
Unitrap ID UNI6239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91566006..91566206 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]


Sequence tag IST10654H10HMR1
Sequence
NTGGAGATATACAAAGTGTGATTACNTTGCTTGACTCTATAGACATCAAACATGCAAGTGCTGCTGGCATAATCCCAGCA
ATCANAACACTGTGACAGGTGTATTAGTCTTCATTTGAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es