Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14382C12
Clone ID IST14382C12
Vector VICTR74
Project tigm

Sequence tag IST14382C12HMF1
Sequence
GAACCTANGGCCTAATGCATGCTAGGCAGGCACTCTACCAAATGAGCTACATTTGCAAAACCTTTATTTATTTCATTTTA
TTTTATTTTTTTAGAAAGAGGACTAAGGAGCCAGGTATGGTAGGTGCACACTTTGATCCCANTACTCAGAGGCAGANGCC
AGCCTGGTCTACATACTGGGATCCAGGACATTTGGGGCTGAGTANAGAGATAAAACAAAACAAAAACAAAAACAAAAACA
AGGTGCGGTGGGTTGGAANACTAAGATGAAAAAAGAATAATGAAGCTGGGCATGGTANAACATACCTTTAATCCCAGCAC
TCANGANTTCCTTGGTCTACAAAGCCNGTCCGGGACANCTGGGGCTTGTTNTTCNNANAANCCTTGTCTTGANCTGCCNT
CCCATACACACNCCAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14382C12HMR1
Sequence
GGTTCTATCTCCNGCACTGCATAAACCGGTAATCCCAAAACTCAGGAGGCAGAGACTGGAAAATCANAACTTTCAAGTTA
TCCTCAGCTACGTAGTGCATTTGAGGCCAACCTGGGCTACATAGACCTACTCTTTCTCACAGGCACCCCAATAAAGGCCA
AAAAAAAAAATCTN
Sequence Type genomic DNA
Unitrap ID UNI31481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13566643..13566815 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033961 (Zfp446) NM_175558 zinc finger protein 446 Gene [Source:MGI (curated);Acc:Zfp446-001]


Sequence tag IST14382C12BBF1
Sequence
NAACCTNNGCCTAATGCATGCTAGGCAGGCACTCTACCAAATGAGCTACATTTGCAAAACCTTTATTTATTTNATTTTAT
TTTATTTTTTTANAAAGAGGACTAAGGAGCCAGGTATGGTAGGTGCACACTTTGATCCCAGTACTCANAGGCAGAGGCCA
NCCTGGTCTACATACTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13566465..13566638 166
 
EST/CDNA Est Name
  BI248133.1

 
Come back to gene BI248133.1


For any suggestions or comments, please send an email to unitrap@crg.es