Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10062B2
Clone ID IST10062B2
Vector VICTR75
Project tigm

Sequence tag IST10062B2HMR1
Sequence
TTCTAAGTCTCATTCNCTACTTATCCATTCTATTAATTTTAATATTCGAATTGTTATTTTGCTTCAGTGTTTGTAAACCA
TCCTGTCCCTCTTAGGAATACATATTANAGAATATGCTCCAAGCCTTTGAACTTATTTGTTATCACCTCTGGTTATCCTA
CTGTAGAATGTTTCTTAGGAATTGTGACAGTTTCATGTGTTGGAAAGGAGCAGGTTAATTTGGCAAGATTTTATTTATTG
CATAATTAGTTCTAAGTGCTTCAGAAAGACAGAACTTACACTAGGGTTAGTTATGTCCAGTTCGTTCTCAGCCAGANTGG
ATGTTTGTGTTAAGGCTGCTAACA
Sequence Type genomic DNA
Unitrap ID UNI5022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82665802..82666145 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078669 (AC113019.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TA34]

 
Come back to gene ENSMUSG00000078669


For any suggestions or comments, please send an email to unitrap@crg.es