Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11036B7
Clone ID IST11036B7
Vector VICTR76
Project tigm

Sequence tag IST11036B7BBF1
Sequence
GCATTAGTTAATAAAATACCTTTTACTTAGGAAACAATATACACTGAAAGATTAAAACTCTTGGCTTCTTGTATAGAAGC
AGAAACAATAAAATTTTTTCTTACATAATGTAAAGTTACATTAGCCATACCTAGAGGCAAAATTTTCTAGTGATTACAGT
TCACTAGAAGCAAAACTCTTTGAATTTAAGCATTATTTTAAACATCTGAATAGATCTGTC

Sequence Type genomic DNA
Unitrap ID UNI31094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89635977..89636195 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060961 (Slc4a4) NP_001129732 solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]


Sequence tag IST11036B7HMF2
Sequence
GCATTAGTTAATAAAATACCTTTTACTTAGGAAACAATATACACTGAAAGATTAAAACTCTTGGCTTCTTGTATAGAAGC
AGAAACAATAAAATTTTTTCTTACATAATGTAAAGTTACATTAGCCATACCTAGAGGCAAAATTTTCTAGTGATTACAGT
TCACTAGAAGCAAAACTCTTTGAATTTAAGCATTATTTTAAACATCTGAATAGATCTGCAACACTGTTAAAAAGAATTTC
TCTTGAACACAGGGAAAAATCTTTCTNAGGCACTGTTTGCAAAACAAAAGAAAGGCCACAAGCTGCTCTGGGGCTGCCCA
GANCCCTGCATTGACTCAAACGTGAAATACTTTTTAATCTGAGCATCCTGGCCCTCCTGTAATAAGGACCGATTTTAGAG
AAACAATATAACTGTCTACGCCTCCAAATNTTGATACTCTTTCTTAAGANGACTTACAGTTAAAACGTTCTTNACAACTT
TAGTGNTGTGAAAAAATTGCCCGTNCTGCAGTTTCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88521069..88521585 503
NO GENE  

 
Come back to gene ENSMUSG00000060961


For any suggestions or comments, please send an email to unitrap@crg.es