Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14892D3
Clone ID IST14892D3
Vector VICTR76
Project tigm

Sequence tag IST14892D3HMR1
Sequence
ATGCCNGTTGGAGGTAGAAGGATAGGCTAGAAAAGGCTTCCTGACTTAAGGAAGAACTTGTCCCACTTCANAATTTTAAT
TTTATTTTAAATTTTAAATATTGTGATGGTTGGAGAAAGAACTTTGTGGACACTGAGAGCTGGTTCAGATAAAGATAGAT
GGGAGAGGCATTTTCCTGGCTTTAAGTGGCAGGTATAATGTAAGAGGAGTCNNNACTGANAGCNTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI6870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29202703..29202931 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037513 (Samd4b) NM_175021 sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2448542]


Sequence tag IST14892D3HMF1
Sequence
CATGGAGTCACATAACACTTTGATATCTTTCTTTTTTGGACTTAGTTCCAACCTTTCATTCTTGATGAGAAATACAGCAA
GTAATATTAAGGACAAAGTCAAAGGCCTTGTATTCCAGCTGTCTGTACAAGAAGCACAGGGTTGCTGAGATGTGGGCTGC
TCAGATTTAGGTAAGGGTGTCTGTGAAGGATTAACGGTCTGCATGTANTTAATGTGCAAGATGTGGCTCANTGATGGGTC
TTTTTCTCCTTGNTCCTGCNTCCCTACCCNGACTTCTNANTTGCNGTTGNTNANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29202929..29203224 274
NO GENE  


Sequence tag IST14892D3BBF1
Sequence
CATGGAGTCACATAACACTTTGATATCTTTCTTTTTTGGACTTAGTTCCAACCTTTCATTCTTGATGAGAAATACAGCAA
GTAATATTAAGGACAAAGTCAAAGGCCTTGTATTCCAGCTGTCTGTACAAGAAGCACAGGGTTGCTGAGATGTGGGCTGC
TCANATTTAGGTAAGGGTGTCTGTGAAGGATTAACGGTCTGCATGTAGTTAATGTGCAAGATGTGGCTCANTGATGGGTC
TTTTTCTCCTTGCTCCTGCATCCCTACCCANACTTCTCAATTGCTGTTGTTTANGCATTACANTGTANNCAGANGCATCT
AAGACACAGANAANCCTTGTCTAAACCTCCCCCACCCNNNNANTACTGCCANGACNNNNNGGCTATGGNANGCNACTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037513


For any suggestions or comments, please send an email to unitrap@crg.es