Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13571D3
Clone ID IST13571D3
Vector VICTR74
Project tigm

Sequence tag IST13571D3HMR1
Sequence
CTCCTGGTTCCNTATTCTCAGAGTGCTCTGTGTATAATCTTATGGTGATCTGGCCANCT
Sequence Type genomic DNA
Unitrap ID UNI435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32855607..32855662 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]


Sequence tag IST13571D3HMF1
Sequence
GGAGGACCTTGAGTTCAAGACTGGCCTTANCTACACAGTGAGACCTTGCCTTAAATACAGTAACAAACAAAAAAGAAAAA
AAATCAACTTTGGAATCTNANAGACNCGGANTCNNNTTCCAGCTTCTTGCTACTTCTAANCTGTGGCAACTGAAAATTCT
AATTTCTTTTAANGNNNTTATAAAANTGAAATANGGATTNNATTCCGTCTACNAACTTANTAANATGGTATATGCNAGCT
CGTTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es