Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P033F06
Clone ID P033F06
Vector FlipROSAbetageo
Project ggtc

Sequence tag P033F06
Sequence
GAACACAAACCCACCACGCCACACAANNAAAAACACCAACACACAAACANCCCNNCCCNNAAANNAAAAANNCCCCACNN
AAAGAGGANNNNCACCCCNNCGGGACCCNAAAACAACCAGAACANNCNNAACCAGNNCGAACAAACAACAAAGAGTACAC
ACCAAAAGAAANNAGCAAAAACACCGCGAAAATCAACTNNACTCCCAGCAGCCAACAGAGGAGCGAACCAAAATAAGGAA
AACGTCTATTTCCACCTTCCCTGCACAGTAAGAAGAAAAAAAAACCCCCGGGGGCGGGGAAGCCATCCATTAAAAGAAAC
CCCTCCCAAGGACCAACAAACCCCCAAGCCGAATCCAACACCAAAAGGGTTAATGGAAGGTGCCCTGACGGCGCTATAGC
GGACGGTCGGGTCTTTCTGGTCTGAGTAGGGAATTGCTTTGTGTCTTCGGTCTCTGCAGA
Sequence Type mRNA
Unitrap ID UNI10719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28516408..28516489 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es