Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14269H3
Clone ID IST14269H3
Vector VICTR74
Project tigm

Sequence tag IST14269H3HMR1
Sequence
GGAGTAATGATTGTGGAGTNATGTAGAGAGAGACTTGGCTTCAGGTTTCCTCATCTGCTTAATGGCCTGGCAGATGTTTC
TTAATATTAGAGTCTCAGTTTCTCCGTGTAGAAG
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59469085..59469198 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST14269H3HMF1
Sequence
CTCCTTAAGTTTTACTGTTCTCTTGGGTATTTTGGAGCTCTGACTCTAAGGTTCTGAAGGTAAGGATGAGCGCACAACTC
TGGGCAACCTAAGGACACTGTGCTCCTCACGCCCAACTGTCAGTCCAAAACCATCTAGAAATGGCAGCGAAACAGACAGC
ATCTTAGGAACAAATTTTGTAACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59468905..59469088 184
NO GENE  

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es