Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13095A10
Clone ID IST13095A10
Vector VICTR76
Project tigm

Sequence tag IST13095A10HMF1
Sequence
GGGCCNTCAGAAGGTCCTATTTGGGGGCAGGTCCCCGGCCTTCTGCGCCTTCCACTCCTGTCCCAGGAAGCCCTTCTGGA
GCCTCTCCCTTTGTTTCGTATTTATTCCTCTTTCAGAGGGACCCCAGGTTCCAGGGACCGACTGAGCCCCGGACCCGCTG
GGGCCTCTGGCCTGCTCCCGGGAGGAGTGCTCTCTCCCGGCCACGACTATGCAACTCTCCCGGGCAGAGGGGCCGGGACT
GCCAGCCAGGCGCCTATTGGA
Sequence Type genomic DNA
Unitrap ID UNI30796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151920783..151921042 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060257 (Scrt2) scratch homolog 2, zinc finger protein (Drosophila) Gene [Source:MGI (curated);Acc:Scrt2-001]

 
Come back to gene ENSMUSG00000060257


For any suggestions or comments, please send an email to unitrap@crg.es