Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10504G12
Clone ID IST10504G12
Vector VICTR76
Project tigm

Sequence tag IST10504G12BBF1
Sequence
AGGCCTTGCAGGAAGTGGGTGTGATTACATTGATGAGAAGCAAGAACCCGAACCCAAAGCCGCTCATGTGGCTGTCGCTC
CCGTGGCTGTCTTCTAAGGCACTTCTCAGTTTCATTGCNTCCACGGAAGAGCATTTACATTTTTATTTCTGCTTTATAAA
AAANAAAGAAAAACCACAATAAGTTCAAAAATTAACACCTCTCCCAAAGCACCGAGAGTANATATCAAAGTCAGCCTCGC
CCTCAGCGCCTTGTCGGCTTCTGTGCTTNNNCAAGTCCATGGCCAACGAAAGGTTTGTCTNTGGTTCACCTCTTGGATAT
AGAGCAAGCTGTCACAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114295731..114296071 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST10504G12HMF1
Sequence
NGGCCTTGCANGAAGTGGGTGTGATTACATTGATGANAANCANGANCCCGAACCCANNNCCGCTCATGTGGCTGTCGCTC
CCNTGGCTGTCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es