Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10921E5
Clone ID IST10921E5
Vector VICTR76
Project tigm

Sequence tag IST10921E5HMR1
Sequence
GAAAGCCNGCCTGGGGTATATGAGGTCTGGCTCAAAGAATCTCTTGAATCAAGTTACATTTAAAAGTAAGTTGTGTAGTA
TACTATTTTATTATTGCTGCTGTTGCTTATATTTGTATGAATTCTGAATCATGAATCATTCTGGAATCTTTGAGCAAGGT
TCTACCTTTGGGTCTAACAGTGTTTCTTTCTGGGCCTCANTACTTTATTTGTAATACAAATAACTACTTCATATAGTACC
CAAGANAGTANATTGANAAGTAGTTTTTGAATTATTAACTATATAAGTGAAGGTTTCAAAATTANTGANGAAGGACANAA
TGTTNANNGGC
Sequence Type genomic DNA
Unitrap ID UNI31491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54426222..54426545 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039156 (Stim2) NM_001081103 stromal interaction molecule 2 Gene [Source:MGI (curated);Acc:Stim2-001]


Sequence tag IST10921E5HMF1
Sequence
AGGATAACCTTGACCTTCTGAACTTCCTGCCTCCACTAGCCACTTGTGGGAACACAGGAGCGCATAACAAGGTCTGGTTT
TATGCANTGCTGAGATCAACCTCTGAGGTTCCTGCAAGCTAGACAAACACTCTACAAACTGANCTNTGTCCCCAGTCCNN
TATCTATTTCTTTANAANTAGCATGTGCCTTTGANAGAGAGTGCAGGAGGGGAGGGGGAGTGGGGACAGGGAGGTGGGGG
AGAACAAAGCTAGTNTACNNTAAAGTGTTANCCAGAAGAATAGCTNTTATGTGAACCACTGNNTGGTTATGCCANACTAN
CTTTAAAAAAAAAANTNNCNNNTGANAAAGTNNCANAGGTCANTTCNGAACGTGCNTNNNNACNTTAAAAAACTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039156


For any suggestions or comments, please send an email to unitrap@crg.es