Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14226D12
Clone ID IST14226D12
Vector VICTR74
Project tigm

Sequence tag IST14226D12HMR1
Sequence
ATATCTGCACACCTTCCCTGTAAGAGAGCTTGCCNGCAGAGAGTGCTCTGAGCACTGAAACTCAGAGGAGAGAATCTGTC
TCCCAGGTCTGCTGAGAGACGGTAACAGAATCACCAGAAGAACAATCTCTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI26969 UNI31495 UNI31496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 45424..45563 138
 
EST/CDNA Est Name
  CN722092.1 - AA186009.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27393479..27393618 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 86952457..86952596 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6435823..6435962 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 96487818..96487957 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107967946..107968085 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 23953606..23953745 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043659 (Npsr1) NM_175678 neuropeptide S receptor 1 Gene [Source:MGI (curated);Acc:Npsr1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 24230080..24230219 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 63204859..63204998 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060843 (Ctnna3) NM_177612 catenin (cadherin associated protein), alpha 3 Gene [Source:MGI (curated);Acc:Ctnna3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15443616..15443755 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 103670520..103670659 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030077 (Chl1) NM_007697 cell adhesion molecule with homology to L1CAM Gene [Source:MGI Symbol;Acc:MGI:1098266]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 68328674..68328813 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 152458930..152459069 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12395386..12395525 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 49606696..49606835 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 112774688..112774827 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 171403601..171403740 138
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 5179944..5180083 138
NO GENE  

 
Come back to gene ENSMUSG00000030077


For any suggestions or comments, please send an email to unitrap@crg.es