Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14132A3
Clone ID IST14132A3
Vector VICTR74
Project tigm

Sequence tag IST14132A3HMR1
Sequence
TGAGTGAGTGAGTGAGTGAGTGTGTGTGTGTGNGTN
Sequence Type genomic DNA
Unitrap ID UNI2076 UNI31500 UNI31501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 81735221..81735255 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12190242..12190276 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 61948515..61948549 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 72612575..72612609 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17850083..17850117 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 89692724..89692758 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021044 (Adck1) NM_028105 aarF domain containing kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1919363]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40869763..40869797 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66833636..66833670 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97636504..97636538 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 116085470..116085504 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29159819..29159853 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54043153..54043187 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15969520..15969554 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9555684..9555718 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20041319..20041353 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037315 (Phf16) NM_199317 PHD finger protein 16 Gene [Source:MGI (curated);Acc:Phf16-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 136209304..136209338 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 99796935..99796969 33
NO GENE  


Sequence tag IST14132A3BBF1
Sequence
CTGCAAAACCCTGGTCTAGCCCGGCAGTAGTGACCTTTAATCCCAGCACTTGGGAGGCNNAGGCAGGCAGATTTCTGAGT
TCGAGGCCNNCCTGGTCTATAGAGTGAGTTCCAGGACAGCCAGGGCTCANGGCTATACAGAGAAACCCTGTCTCAAAAAA
CCAAGAACAAACAAACAAACAAAAAACCCACCACCAACAACAAAAAAATCCTGGTCTAAGTATATAACCTCTCCAGGTCC
TGGACAGATGGCTGANANATTAAGAGAATGGGCTTGCTTCTCTTGCAAAGAACCNACATGACAGGTGACAACTCCNATTT
CACAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29159445..29159773 311
NO GENE  

 
Come back to gene ENSMUSG00000037315


For any suggestions or comments, please send an email to unitrap@crg.es