Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14025D7
Clone ID IST14025D7
Vector VICTR74
Project tigm

Sequence tag IST14025D7BBF1
Sequence
CTTTACAACTCTGGGATCTTTCCATCTTCTGAGGTCTTTAAATTCTTTCTTGAGAGACTTGAAGTTCTTATCATACAGAT
CTA
Sequence Type genomic DNA
Unitrap ID UNI31502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17659409..17659476 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055137 (5033411D12Rik) NM_138654 RIKEN cDNA 5033411D12 gene Gene [Source:MGI Symbol;Acc:MGI:1923221]

 
Come back to gene ENSMUSG00000055137


For any suggestions or comments, please send an email to unitrap@crg.es