Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14384G11
Clone ID IST14384G11
Vector VICTR74
Project tigm

Sequence tag IST14384G11HMF2
Sequence
TTAGCAACTGATGCAGATTTGCACAGCCAAATGTTAGAGTGGACTCAGGGAACCCTGAGGAAGATGGGGAGCGTAGGAGC
CAGAGGGGTCACGAACACCCCCAAGAAAAACCAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84308997..84309112 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]


Sequence tag IST14384G11HMR1
Sequence
NTATTAATTTCTGAAGTGAGCGANGCCAAGTACTTACNGAAGGTAAGGTGGACTTTTGGCAGTTCTGACTACTGTCCCCA
TANAGTCCTGACTTTTGGGAAAAAACAAACAAACAACATCTTTCTCTCTCTATTTCTTTCCCCCTTAGTATTAATCTCTC
ATTTGATCGTCTTCCTTCTTTAGTGGGAAGTTAAAGGGTTTATAAAAAGATTTTTTTTTTAAAACCTTCNNCTTTTGGAA
Sequence Type genomic DNA
Unitrap ID UNI35413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66541558..66541795 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070780 (Rbm47) NM_139065 RNA binding motif protein 47 Gene [Source:MGI (curated);Acc:Rbm47-001]


Sequence tag IST14384G11BBF1
Sequence
ATACCATTNACAGCCCGGTAGCAATCTACAAGGCTAGGAAGTCACCTACAACATCTTCGCTGGCCGCACACTTTTAAATA
GAAAACTAAATTAAAGAGTCTCCAAACTACTTCCCACCGTGCGGCTTAAAGCAACAGATCAGATCGCTCTAGGCTTTAAC
TCTTCCCGGGTTCTGGGAATTCCAGTTTGTCACAATTTCTTAGCCTGAGTGACCTGCGGTAAGAAACGTCTTCCCGGCCC
AGAGCCTGGCTTCTCCGGGTCCGGGCGCTCGGCGGCCGGCTGGGCTGGGTCGTACGAGCCGGCTGCGGTGCGGCTGTGGC
CCGGGCGGANCGGCACAGGGTCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66541793..66542139 343
 
EST/CDNA Est Name
  AK035620.1 - NM_178446.2

 
Come back to gene AK035620.1 - NM_178446.2


For any suggestions or comments, please send an email to unitrap@crg.es