Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P027A10
Clone ID P027A10
Vector FlipROSAbetageo
Project ggtc

Sequence tag P027A10
Sequence
CCGCCACCACCGCCGCTGCCGCCGCGGTCTTTCTCTGTCTCAGCTGAGGCAGCCATCTTGCTCTTGCCGCGTGCTGGTGT
TGGAGGACCCTCCCCGCTGCAG
Sequence Type mRNA
Unitrap ID UNI6211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108506113..108506214 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es