Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12315G1
Clone ID IST12315G1
Vector VICTR76
Project tigm

Sequence tag IST12315G1BBF1
Sequence
AAGGAGGCTCGTGAGAAGCTGGAGATGGAGATGGAGGCTGCACGTCATGAGCACCAGGTTATGCTAATGAGGCAGGGTGA
GTAGAGGCCTGTAAGTAGGGAAAGTGGAATACATATCAAATACCAGTTTTGTTCAGTAATTTCTTTATTTCTTAGTAGAA
AAAGACAAAGTCTCTGTTTTTATTCCCTGAAATACTTTGTTTATCCTAGTAGGGAGATGAATTTGGAGATGGGTATAGAA
TACTAGAAGAGTCAATGAAGAAAGAAATGGTTAAGTTTGAGTTTACTTGCATGATCCTTCTGGGATTATATATTGTCTTA
GTTAAGGGTTCTGTTGCTGTGATAATACACGAAGCATGGCCAAAAGCAGTTTAAGGAGAAAAAGGTTTATTTTATCTTAA
AATTTAGGTCACTGAGAGACGCTAAGGCAGGAACTAATGTTGATTAGATTGTTACCCAGGGCTTGTCCNTCCCCCCCTTT
GTTTATTTTTGGATGTTGATGTTTTTGGGGGTT
Sequence Type genomic DNA
Unitrap ID UNI31504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98638755..98639267 511
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]


Sequence tag IST12315G1HMF1
Sequence
AAGGAGGCTCGTGAGAAGCTGGAGATGGAGATGGAGGCTGCACNNNNNGAGCACCANGNNANGCTAATGAGGCAGGGTGA
NNANANGNNNGTNANNANGGAAAGNGGAATACATATCAAATACCNNNANNGTTCAGTNNNNNNTNTATTTCTTAGTAGAA
AAAGACANNNNCNNTGNNNNTANNCNCTGAAATACTTTGTTTATCCTAGTAGGGAGATGANNNNNNAGATGGGTATAGAA
TACTAGAANAGTCAATGAAGAAAGAAATGGTTAANNNNGAGTTTACTTGCATGATCCTTCTGGGATTATATATTGTCTTA
NTTAAGGGTTCTGTTGCTGTGATAATACACGAAGCATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es