Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G064B07
Clone ID G064B07
Vector U3CEO
Project ggtc

Sequence tag G064B07
Sequence
ATTGCAGTGGCCAGCGAGATCATGGCCGTGCTGGCCTTGCCTGATAGCCTCACAGACATGAAAGAGCGGCTAGGAAGAAT
GGTGGTGGCCAGTGACAAAGACGGGCAGCCTGTGACAGCTGAGGACTTGGGGGTGACCGGCGCTCTGACAGTTTTGATGA
AAGACGCCATCAAGCCAAATCTGATGCAGACCCTTGAAGGAACACCTGTGTTTGTGCACGCTGGTCCCTTTGCCACCGTA
GGTCAGGGCAGCTCATCAGTATGAGATGATATAATCGCGCTCAATTTGGTCGGCGAAGATGGGTTTGG
Sequence Type mRNA
Unitrap ID UNI11070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6289683..6298698 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es