Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12016F5
Clone ID IST12016F5
Vector VICTR76
Project tigm

Sequence tag IST12016F5BBF1
Sequence
GTGGCATAATCACCACTGAAATGCATAGACAGGCAGTGAGAGGCTCCAGCCATGGGTGGGAGAGGCGTGGCTTCCTGTCA
GTGCTGCCTTTAGCTTTTCCAAGGTTCTGCCACAGGATGCCGTTCCTAGTCTTGGATTTCATGAAACCTAGCAATCATTT
TCCTTCTCTCAGGTACAATGAAGAAGATACTAAGAAGCTGAAGGCATACCATTCCCTCCATGGAAACGACTGGAAAAAGA
TTGGGGCCNTGGTGGCCCGAAGCAGCCTCTCAGTCGCCCTCAAGTTCTCTCAGATTGGTGGTAGTAAGTGGCCTCTCTGT
GAAATAAGCCCATGACTGANCCNATGTGCANNNGCCTCTGTGGTCCACTCTTANTGTGTGCTCCTTTTAAAGACCCTCTC
TATGCCTGTTCCTTTGACTTCTCTGTGTGCACTAACNNTGCCTCANTCCATACCCNGCTGCATGAACTGCTACNCATGCC
GGTCCTTCCAGANNTTGNCCN
Sequence Type genomic DNA
Unitrap ID UNI31512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28929237..28929736 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]


Sequence tag IST12016F5HMF1
Sequence
GTGGCATAATCACCACTGAAATGCATAGACAGGCAGTGAGAGGCTCCAGCCATGGGTGGGAGAGGCGTGGCTTCCTGTCA
GTGCTGCCTTTAGCTTTTCCAAGGTTCTGCCACAGGATGCCGTTCCTAGTCTTGGATTTCATGAAACCTAGCAATCATTT
TCCTTCTCTCAGGTACAATGAAGAAGATACTAAGAAGCTGAAGGCATACCATTCCCTCCATGGAAACGACTGGAAAAAGA
TTGGGGCCATGGTGGCCCGAAGCAGCCTCTCANTCGCCCTCAAGTTCTCTCAGATTGGTGGTAGTAAGTGGCCTCTCTGT
GAAATAAGCCCATGACTGAGCCAATGTGCAGAGGCCTCTGTGGTCCNCTCTTANTGTGTGCTCCTTTTAAAGACCCTCTC
TATGCCTGTTCCTTTGACTTCTCTGTGTGCACTANNCATGCCTCANTCCATACCCTGCTGCATGAACTGCTACGCNTGCC
GGTCCTTCCANAAN
Sequence Type genomic DNA
Unitrap ID UNI31512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28929237..28929729 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]

 
Come back to gene ENSMUSG00000026803


For any suggestions or comments, please send an email to unitrap@crg.es