Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14880D2
Clone ID IST14880D2
Vector VICTR76
Project tigm

Sequence tag IST14880D2HMF1
Sequence
CAAAGGGTCCCGTGAAGGCCACAGATAGGACCGAGAAAAATGGACACACTGTGGCGGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI30796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151916939..151916999 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060257 (Scrt2) scratch homolog 2, zinc finger protein (Drosophila) Gene [Source:MGI (curated);Acc:Scrt2-001]


Sequence tag IST14880D2BBF1
Sequence
CAAAGGGTCCCGTGAAGGCCACAGATAGGACCGAGAAAAATGGACACACTGTGGCGGTGTTGACGTGTAGCATGTCCAGA
TTTCAACCTGTGTCCACCCCAAATACCAAAAAAGACAGAGGCCGGAGGATGGTGAGCCAGGTCCTTTAAGGGAAAGAAGC
TAGCCAAAGTGCCGGGCCTGCCAGACATAACTGGAACTGTGCTTACAAANCCNGCTGCTCCTTCACNAGGAANCCATGGG
CAGAGGGGCGTTACAGGTCCCTGANGTCAGATGGANAGGGCCNAATGGGACTGGCCCTNNTNANCNGNNAAANCTNANNA
AAGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000060257


For any suggestions or comments, please send an email to unitrap@crg.es