Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0404
Clone ID CH0404
Vector pGT0lxr
Project sanger

Sequence tag CH0404
Sequence
CCGAAGCCAAGGTTCCACGCGGAGACTGGGGGCTTAGAACCCGGGCTGGGAGGGCGAGACTGTGCGGGAGGGAGCCGCTT
CTTAGCCTGTCCTACGGAAGCCTGCGAGGGAGGGTGGTATCCACTCCCCAAATCCAGTGTCCTGATGCCCAGCGCCAACG
CCAGCCGTAAGGGTCAGGAGAAGCCGCGGGAGATCGTGGACGCGGCGGAA
Sequence Type mRNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130313729..130313938 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]

 
Come back to gene ENSMUSG00000026356


For any suggestions or comments, please send an email to unitrap@crg.es