Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11502C7
Clone ID IST11502C7
Vector VICTR76
Project tigm

Sequence tag IST11502C7HMF1
Sequence
GTGGCACACACCTTTAATTCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGAN
Sequence Type genomic DNA
Unitrap ID UNI19885 UNI22564 UNI31520 UNI31521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 57190013..57190067 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 105082549..105082603 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046169 (Adamts6) NM_001081020 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6 Gene [Source:MGI Symbol;Acc:MGI:1347348]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 123599840..123599894 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23759028..23759082 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25358885..25358939 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5792362..5792416 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 107918245..107918299 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 125668977..125669031 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6131216..6131270 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124444993..124445047 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038527 (C1rl) NM_181344 complement component 1, r subcomponent-like Gene [Source:MGI (curated);Acc:C1rl-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88308592..88308646 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025726 (Slc28a1) NM_001004184 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 Gene [Source:MGI (curated);Acc:Slc28a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 42110641..42110695 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045636 (Mtus1) NM_001005865 mitochondrial tumor suppressor 1 Gene [Source:MGI (curated);Acc:Mtus1-001]

 
Come back to gene ENSMUSG00000045636


For any suggestions or comments, please send an email to unitrap@crg.es