Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15060C11
Clone ID IST15060C11
Vector VICTR80
Project tigm

Sequence tag IST15060C11HMF1
Sequence
GTAGTGTAATGGTTTTCTTAGGTGATAGTAAAACAGTATTAAGAATGTAAACTGTTCTCTGCGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34850070..34850135 66
NO GENE  


Sequence tag IST15060C11HMR1
Sequence
CTCCCTTCCNGTGTAGTGTTGGGGGAAAGGGAGACATAATGGGAAGGGAACTGAAACAATTTCCACTACAGATAGAGAAA
TAATTCCGAATGAGGTGGTAATCTCTTTTCTACGGACCCAGCCCGTAACTAGGCCTCATCATTGACATTTAAAGCTTTTA
GTCTGGTCAAAGGCAAGTTGTTTGTTAATTAAATGATTTGAAGTAGGGAGAATAATGGAGTGTCTGAGTAGCCTATTTCA
GAATACTGTTTACCAGTGTCAGGCTCTCCTAGGGCAATGCCTCTGTGACTAGTGTTGTACTGTGAAACTTCNTTATGATG
TCCCTCATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI13226

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65929320..65929651 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029203 (Hip2) NM_016786 ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI (curated);Acc:Hip2-003]

 
Come back to gene ENSMUSG00000029203


For any suggestions or comments, please send an email to unitrap@crg.es