Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14976F3
Clone ID IST14976F3
Vector VICTR76
Project tigm

Sequence tag IST14976F3HMR1
Sequence
TTAGTAAGACTGTTAGTGTCCTAGCCTACACATCTTCATCACAGACAGGGAAGCTCAGTAGCCGAAGACACCGAATTCTG
TTC
Sequence Type genomic DNA
Unitrap ID UNI14706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32262697..32262778 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027663 (Zmat3) NM_009517 zinc finger matrin type 3 Gene [Source:MGI (curated);Acc:Zmat3-001]


Sequence tag IST14976F3BBF1
Sequence
CTAAAATGACTCAAGGACGCTTTAAGAGGGAAAAAAACATTTGTAGACACACAGTGGAGAGGAGCCACTGACTGGGAAGT
CATTCAGTTAANAGTGGTTAGTCTTAATATTTAGCAACACTTTTCATTAATCATAATGGCTAGAAAAGGATAATAATCAA
CTACCCGTATCTCTGGAAACACAAAGGAAAGTGATACAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32262775..32262978 202
NO GENE  

 
Come back to gene ENSMUSG00000027663


For any suggestions or comments, please send an email to unitrap@crg.es